View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_108 (Length: 324)
Name: NF1390_low_108
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_low_108 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 31 - 236
Target Start/End: Original strand, 15228234 - 15228439
Alignment:
Q |
31 |
caaaggacaagctcattactacatagatcacattaaataggaaacggttccattattcaaccacattatgtaacaatacatttattaaaatactagcttg |
130 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15228234 |
caaaggacaagctcattactaaatagatcacattaaataggaaacggttccattattcaaccacattatgtaacaatacatttattaaaatactagcttg |
15228333 |
T |
|
Q |
131 |
tcattcaactcattaaacttctatgcagcaagtgattgaacatactcatccacctcaatgaagttcttgactgcaaaatctttgacaatacttggatcag |
230 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
15228334 |
tcattcaactcattaaacttctatgcagcaagtgattgaacatactcatccacctcaatgaagttcttgactgcaaaatttttgacaatacttggatcag |
15228433 |
T |
|
Q |
231 |
gaatat |
236 |
Q |
|
|
|||||| |
|
|
T |
15228434 |
gaatat |
15228439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12982 times since January 2019
Visitors: 8270