View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_117 (Length: 317)
Name: NF1390_low_117
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_low_117 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 97 - 176
Target Start/End: Original strand, 33794812 - 33794891
Alignment:
Q |
97 |
caatcaacattagaactacatcaatccaatcaccatatctcaaaattatgcctattgaacctccctcttttactttcatc |
176 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33794812 |
caatcaacattagaactacatcaatccaatcaccatatctcaaaattatgcctattgaacctccctcttttactttcatc |
33794891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13398 times since January 2019
Visitors: 8302