View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_120 (Length: 312)
Name: NF1390_low_120
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_low_120 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 193 - 299
Target Start/End: Original strand, 1052001 - 1052107
Alignment:
Q |
193 |
aatataacactttgtccatctttcaatcttcttgtaaccacattattagaatatgtaaatatctttattacagattctaatacccatcatgaaaccactc |
292 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1052001 |
aatataacactttgtccatctttcaatcttcttgtaaccacattattagaatatgtaaatatctttattacagattctaatacccatcatgaaaccactc |
1052100 |
T |
|
Q |
293 |
ataagta |
299 |
Q |
|
|
||||||| |
|
|
T |
1052101 |
ataagta |
1052107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10495 times since January 2019
Visitors: 7978