View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_127 (Length: 288)
Name: NF1390_low_127
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_low_127 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 30 - 288
Target Start/End: Complemental strand, 37804654 - 37804396
Alignment:
Q |
30 |
caacaaatcattaacttaattcaataccgttagtaaaccgagagcctcaccaatatcaactttcataagaggttcaatccattctgtttcagcaagaaca |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37804654 |
caacaaatcattaacttaattcaataccgttagtaaaccgagagcctcaccaatatcaactttcataagaggttcaatccattctgtttcagcaagaaca |
37804555 |
T |
|
Q |
130 |
aagcgcccttgttcgtcacaaacattgatacccaccttaatatgctcatgagactgagagaatgagacatcaacattgaacttgtctgtacctaattgag |
229 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
37804554 |
aagcgcccttgttcgtcacaaacattgattcccaccttaatatgctcacgagactgagagaatgagacatcaacattgaacttgtatgtacctaattgag |
37804455 |
T |
|
Q |
230 |
cttttgaccgaactgagggtgatcatacatgctgctgtaccgtggtggaaattctgtgt |
288 |
Q |
|
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37804454 |
cttttgacggaactgcgggtgatcatacatgctgctgtaccgtggtggaaattctgtgt |
37804396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 76 - 129
Target Start/End: Complemental strand, 46232105 - 46232052
Alignment:
Q |
76 |
tcaccaatatcaactttcataagaggttcaatccattctgtttcagcaagaaca |
129 |
Q |
|
|
|||||||||||||||| ||||||||| |||||||||||||||| |||| ||||| |
|
|
T |
46232105 |
tcaccaatatcaacttccataagagggtcaatccattctgttttagcaggaaca |
46232052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12403 times since January 2019
Visitors: 8218