View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_132 (Length: 281)
Name: NF1390_low_132
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_132 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 60 - 241
Target Start/End: Complemental strand, 4872118 - 4871937
Alignment:
| Q |
60 |
ggatattaagaagggaagaaaaaagagcgatataatcggatatggtagagtaaccgcgagagagcatgtcatcgaaatcacgagtagcagaattgatata |
159 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4872118 |
ggatattaagaagggaagaaaaaagagcgttataatcggatatggtagagtaaccgcgagagagcatgtcatcgaaatcacgagtagcagaattgatata |
4872019 |
T |
|
| Q |
160 |
agctattgtttccttcacccatttatagtaacaaggaggacgaggaagaggaggcatgtctatgaatggatcacaagtataa |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4872018 |
agctattgtttccttcacccatttatagtaacaaggaggacgaggaagaggaggcatgtctatgaatggatcacaagtataa |
4871937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14239 times since January 2019
Visitors: 8375