View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_136 (Length: 271)
Name: NF1390_low_136
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_low_136 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 49 - 241
Target Start/End: Complemental strand, 3167288 - 3167098
Alignment:
Q |
49 |
acatatagagccacccatttggccattgtttttggagttagaaaaagcatgacaacgtttcttttttcagttcaatgtgtacaacgttgtctttgtacgt |
148 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3167288 |
acatatagagcaacccatttggccattgtttttggagttagaaaaagcatgacaacgtttcttttttcagttcaatgtgtacaacgttgtctttgtacgt |
3167189 |
T |
|
Q |
149 |
atggttactattgaatttaactggtatggactgatatagtgaggagtacgggacgacgggtatccatggaccatggccaggtacccctctctg |
241 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||| ||||||||||||||||||||| ||||||||| ||||||| |
|
|
T |
3167188 |
atggttactattgaatttaactggtatggactgatat--tgaggaggacgggatgacgggtatccatggaccatgtccaggtacctctctctg |
3167098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16038 times since January 2019
Visitors: 3757