View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_145 (Length: 257)
Name: NF1390_low_145
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_low_145 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 5 - 223
Target Start/End: Original strand, 22581594 - 22581812
Alignment:
Q |
5 |
aatttgggagctctatgatttacatatcattatcgaagatatgatatgaaacatgtgaattcaaggacaccttcgtgcttctggctaacgtacgttcaac |
104 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
22581594 |
aatttgggagctctatgatttacacatcattatcgaagatatgatatgaaacatgtgaattcaaggacaccttcgtgcttctggctaacgtacgttcagc |
22581693 |
T |
|
Q |
105 |
catcattattcaattaataacaaaaacatagaaatttaaattgggaaactaatgatagtgataggttatgatgaggacaatatttttatttttgatagga |
204 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
22581694 |
catcattattcaattaataacaaaaacatagaaatttaaattgggaaactaatgatagtgataggttatgatgaggacaatatttatatttttgatagga |
22581793 |
T |
|
Q |
205 |
gatgatgaatgaggacaat |
223 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
22581794 |
gatgatgaatgaggacaat |
22581812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11553 times since January 2019
Visitors: 8091