View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_148 (Length: 253)
Name: NF1390_low_148
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_148 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 42 - 253
Target Start/End: Complemental strand, 2813746 - 2813530
Alignment:
| Q |
42 |
agatattgagatttgaagagcttcatctttagctcaatggtattaaaaaccgcaccactct-----ctatatattcaccaatccatatggaaaaagctat |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
2813746 |
agatattgagatttgaagagcttcatctttagctcaatggtattaaaaaccacaccactctactctctatatattcaccaatccatatggaaaaagttat |
2813647 |
T |
|
| Q |
137 |
caaaattttcggatccattcatccgaatataagaaaaaacaatattttctcaatgtcaatccattcaggagatactctcatagcacttggagttggatat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2813646 |
caaaattttcggatccattcatccgaatataagaaaaaacaatattttctcaatgtcaatccattcaggagatactctcatagcacttggagttggatat |
2813547 |
T |
|
| Q |
237 |
gaagttttagagctact |
253 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2813546 |
gaagttttagagctact |
2813530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12499 times since January 2019
Visitors: 8218