View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_low_164 (Length: 243)

Name: NF1390_low_164
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_low_164
NF1390_low_164
[»] chr4 (1 HSPs)
chr4 (1-214)||(2813318-2813531)


Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 2813531 - 2813318
Alignment:
1 cttttatcctactcatttcaccacacgtgatgaatgtccagataattaatatcccacaattaattactatcccaagtctaagcaattgggaacagaagca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
2813531 cttttatcctactcatttcaccacacgtgatgaatgtccagatgattaatatcccacaataaattactatcccaagtctaagcaattgggaacagaagca 2813432  T
101 aagtgttttgatctagaaaaggtgggaagggaaaaattaggaacacagagaaattgctgcagaaaaattgggaataagtgtgatgaagacgagagaagat 200  Q
    |||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
2813431 aagtgttttgatctagaaaaggtgggaagggaaaaattaggatcacaaagaaattgctgcagaaaaattgggaataagtgtgatgaagacgagagaagat 2813332  T
201 gcgtgtgatgaaga 214  Q
     |||||||||||||    
2813331 acgtgtgatgaaga 2813318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 11664 times since January 2019
Visitors: 8091