View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_164 (Length: 243)
Name: NF1390_low_164
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_low_164 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 2813531 - 2813318
Alignment:
Q |
1 |
cttttatcctactcatttcaccacacgtgatgaatgtccagataattaatatcccacaattaattactatcccaagtctaagcaattgggaacagaagca |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2813531 |
cttttatcctactcatttcaccacacgtgatgaatgtccagatgattaatatcccacaataaattactatcccaagtctaagcaattgggaacagaagca |
2813432 |
T |
|
Q |
101 |
aagtgttttgatctagaaaaggtgggaagggaaaaattaggaacacagagaaattgctgcagaaaaattgggaataagtgtgatgaagacgagagaagat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2813431 |
aagtgttttgatctagaaaaggtgggaagggaaaaattaggatcacaaagaaattgctgcagaaaaattgggaataagtgtgatgaagacgagagaagat |
2813332 |
T |
|
Q |
201 |
gcgtgtgatgaaga |
214 |
Q |
|
|
||||||||||||| |
|
|
T |
2813331 |
acgtgtgatgaaga |
2813318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11664 times since January 2019
Visitors: 8091