View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_low_169 (Length: 230)

Name: NF1390_low_169
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_low_169
NF1390_low_169
[»] chr8 (2 HSPs)
chr8 (3-95)||(1116539-1116631)
chr8 (186-230)||(36170761-36170805)


Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 3 - 95
Target Start/End: Original strand, 1116539 - 1116631
Alignment:
3 atcagtatcatggctttaccactcgtcatctccgttttcaaacctctctcaaccaccacccccctccactctacacttctacgccgccgctgt 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1116539 atcagtatcatggctttaccactcgtcatctccgttttcaaacctctctcaaccaccacccccctccactctacacttctacgccgccgctgt 1116631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 230
Target Start/End: Complemental strand, 36170805 - 36170761
Alignment:
186 cctttattttgcatatttcatccttagtaaccatctttggagaat 230  Q
    |||||||||||| ||||||| |||||||| |||||||||||||||    
36170805 cctttattttgcgtatttcaaccttagtagccatctttggagaat 36170761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 16203 times since January 2019
Visitors: 3768