View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_171 (Length: 228)
Name: NF1390_low_171
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_low_171 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 20 - 112
Target Start/End: Original strand, 1116539 - 1116631
Alignment:
Q |
20 |
atcagtatcatggctttaccactcgtcatctccgttttcaaacctctctcaaccaccacccccctccactctacacttctacgccgccgctgt |
112 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1116539 |
atcagtatcatggctttaccactcgtcatctccgttttcaaacctctctcaaccaccacccccctccactctacacttctacgccgccgctgt |
1116631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11960 times since January 2019
Visitors: 8179