View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_175 (Length: 219)
Name: NF1390_low_175
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_175 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 80 - 169
Target Start/End: Original strand, 39974105 - 39974193
Alignment:
| Q |
80 |
tctcgaacaaaattggtcttacctccagagtcaattctaacttgaaagctaaaaatggaagcttttgattttaaaattgattataacact |
169 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39974105 |
tctcgagcaaaattggtcttacctccagagtcaattctaacttgaa-gctaaaaatggaagcttttgattttaaaattgattataacact |
39974193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 87 - 161
Target Start/End: Original strand, 31515905 - 31515978
Alignment:
| Q |
87 |
caaaattggtcttacctccagagtcaattctaacttgaaagctaaaaatggaagcttttgattttaaaattgatt |
161 |
Q |
| |
|
|||||||| | ||||||||||||||| |||||||||| |||||| | || ||||||||||||||||||||||||| |
|
|
| T |
31515905 |
caaaattgattttacctccagagtcacttctaacttg-aagctatagattgaagcttttgattttaaaattgatt |
31515978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 113 - 169
Target Start/End: Original strand, 44439256 - 44439311
Alignment:
| Q |
113 |
attctaacttgaaagctaaaaatggaagcttttgattttaaaattgattataacact |
169 |
Q |
| |
|
||||||||||||| ||||||| | | ||||||||||| ||||||||||| ||||||| |
|
|
| T |
44439256 |
attctaacttgaa-gctaaaatttggagcttttgattctaaaattgattttaacact |
44439311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8650 times since January 2019
Visitors: 7803