View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_177 (Length: 218)
Name: NF1390_low_177
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_low_177 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 35672344 - 35672220
Alignment:
Q |
1 |
aaatctaagaaaatatattcttttgtgcatttgtgttgataaaatatcttcttaatgtgtagtggtttgggtgtgtctgaaatgcatttgtgctaacaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
T |
35672344 |
aaatctaagaaaatatattcttttgtgcatttgtgttgataaaatatcttcttaatgtgtggtggtttgggtgtgtgtgaaatgcatttgtgcttacaaa |
35672245 |
T |
|
Q |
101 |
ttagggattgggttatgttgatgat |
125 |
Q |
|
|
||| |||||||||| |||||||||| |
|
|
T |
35672244 |
ttaaggattgggttctgttgatgat |
35672220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 35672406 - 35672369
Alignment:
Q |
1 |
aaatctaagaaaatatattcttttgtgcatttgtgttg |
38 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
T |
35672406 |
aaatctaagaaaatatcttcttttgtgcatttgtgttg |
35672369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 38456487 - 38456450
Alignment:
Q |
1 |
aaatctaagaaaatatattcttttgtgcatttgtgttg |
38 |
Q |
|
|
|||||||||||||||| ||||||||||| ||||||||| |
|
|
T |
38456487 |
aaatctaagaaaatatcttcttttgtgcttttgtgttg |
38456450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9878 times since January 2019
Visitors: 7932