View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_180 (Length: 210)
Name: NF1390_low_180
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_low_180 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 111 - 181
Target Start/End: Original strand, 44840918 - 44840988
Alignment:
Q |
111 |
ctcatttcatttcttgttttctaactattattannnnnnnctttcattttatgagcagagaaggaaaaaag |
181 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||||||| |
|
|
T |
44840918 |
ctcatttcatttcttgttttctaactattattatttttttctttcattttataagcagagaaagaaaaaag |
44840988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11538 times since January 2019
Visitors: 8091