View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_low_180 (Length: 210)

Name: NF1390_low_180
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_low_180
NF1390_low_180
[»] chr3 (1 HSPs)
chr3 (111-181)||(44840918-44840988)


Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 111 - 181
Target Start/End: Original strand, 44840918 - 44840988
Alignment:
111 ctcatttcatttcttgttttctaactattattannnnnnnctttcattttatgagcagagaaggaaaaaag 181  Q
    |||||||||||||||||||||||||||||||||       |||||||||||| ||||||||| ||||||||    
44840918 ctcatttcatttcttgttttctaactattattatttttttctttcattttataagcagagaaagaaaaaag 44840988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 11538 times since January 2019
Visitors: 8091