View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_181 (Length: 210)
Name: NF1390_low_181
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_181 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 97 - 204
Target Start/End: Complemental strand, 44840736 - 44840631
Alignment:
| Q |
97 |
gtgttctgtctgagttcgtaaccaagtgttgattatgatgcccctttttgagtgtgtgtatatgtatacctgcttcattaggttaacatttctctgtata |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44840736 |
gtgttctgtctgagttcgtaaccaagtgttgattataatgcccctttttgagt--gtgtatatgtatacttgcttcattaggttaacatttctctgtata |
44840639 |
T |
|
| Q |
197 |
ttgttgga |
204 |
Q |
| |
|
||| |||| |
|
|
| T |
44840638 |
ttggtgga |
44840631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 44840832 - 44840785
Alignment:
| Q |
1 |
ttttgtgttttgaacggttgtgatgaagcagtgtaaaaagtgaactag |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44840832 |
ttttgtgttttgaacggttgtgatgaagcagtgtaaaaagtgaactag |
44840785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15805 times since January 2019
Visitors: 3757