View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_182 (Length: 207)
Name: NF1390_low_182
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_182 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 43200473 - 43200336
Alignment:
| Q |
1 |
catatctctaaaagctcacaactaaattacctgctagatataacatcaaaagtttacattgattgtgtatttttcattgataaagcatctttacatcagt |
100 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43200473 |
catatctataaaagctcacaactaagttacctgctagatataccatcaaaagtttacattgattgtgtatttttcattaataaagcatctttacatcagt |
43200374 |
T |
|
| Q |
101 |
taattagaatgtaactatccatgttactattttgttgg |
138 |
Q |
| |
|
|||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
43200373 |
taattagaatgtaactattcatattactactttgttgg |
43200336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13117 times since January 2019
Visitors: 8270