View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_46 (Length: 465)
Name: NF1390_low_46
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_low_46 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 29 - 453
Target Start/End: Original strand, 40208407 - 40208831
Alignment:
Q |
29 |
aaatagtgtaccaagttggtttaaacatttcacctggttcatcttgtcattgtacagaaccaggttggtttcgtgtgtgtttcgcaaacatgtcagaaga |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40208407 |
aaatagtgtaccaagttggtttaaacatttcacctggttcatcttgtcattgtacagaaccaggttggtttcgtgtgtgtttcgcaaacatgtcagaaga |
40208506 |
T |
|
Q |
129 |
gactttgaaactagcaatgaaaaggttgaaagctttcgttgttgagtccaccggcaatgttaatggtgttacaacaaaaagcacaaagagaaatttactc |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40208507 |
gactttgaaactagcaatgaaaaggttgaaagctttcgttgttgagtccactggcaatgttaatggtgttacaacaaaaagcacaaagagaaatttactc |
40208606 |
T |
|
Q |
229 |
actaagtgggtttttcggttatcgtctcgtgatcaacgtgatcaacaagaggaacggtaacttggtggtgattggtgatgatcgtannnnnnnnnnnnnn |
328 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40208607 |
actaagtgggtttttcggttatcgtctcgtgatcaacgtgatcaacaagaggaacggtaacttggtggtgattggtgatgatcgtagtgtgtgtgtgtgt |
40208706 |
T |
|
Q |
329 |
naagtgctgaagtttgaagaaactagccatgcacaatattacacnnnnnnnnnnnnnnnnnnnnnnnngcactccccagttatttcttggaggagtagtt |
428 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
40208707 |
gaagtgctgaagtttgaagaaactagccatgcacaatattacacttttatttttatttttttctttttgcactccccagttatttcttggaggagtagtt |
40208806 |
T |
|
Q |
429 |
caaaaaatgttatttactatatatt |
453 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
40208807 |
caaaaaatgttatttactatatatt |
40208831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 52 - 155
Target Start/End: Complemental strand, 5134116 - 5134013
Alignment:
Q |
52 |
aacatttcacctggttcatcttgtcattgtacagaaccaggttggtttcgtgtgtgtttcgcaaacatgtcagaagagactttgaaactagcaatgaaaa |
151 |
Q |
|
|
||||||||||||||| | || |||||||| || ||||| || ||||||||||| ||||| || |||||||||||||| || || || |||| ||||||| |
|
|
T |
5134116 |
aacatttcacctggtgcttcatgtcattgcaccgaacctgggtggtttcgtgtttgttttgctaacatgtcagaagatacattaaacttagctatgaaaa |
5134017 |
T |
|
Q |
152 |
ggtt |
155 |
Q |
|
|
|||| |
|
|
T |
5134016 |
ggtt |
5134013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8520 times since January 2019
Visitors: 7803