View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_low_52 (Length: 456)

Name: NF1390_low_52
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_low_52
NF1390_low_52
[»] chr1 (2 HSPs)
chr1 (191-315)||(27623248-27623372)
chr1 (377-443)||(27623119-27623185)


Alignment Details
Target: chr1 (Bit Score: 101; Significance: 7e-50; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 191 - 315
Target Start/End: Complemental strand, 27623372 - 27623248
Alignment:
191 atttttatgacccagatctaccctttttccttacttgttttatgtaatgtagggtctcaaagattataaagaaaatgaagagagnnnnnnnngacacaag 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||    
27623372 atttttatgacccagatctaccctttttccttacttgttttatgtaatgtagggtctcaaagattataaagaaaatgaagagagaaaaaaaagacacaag 27623273  T
291 tgagttttgttattctttttgcatc 315  Q
    |||||||||||||||||||||||||    
27623272 tgagttttgttattctttttgcatc 27623248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 377 - 443
Target Start/End: Complemental strand, 27623185 - 27623119
Alignment:
377 gaggttttgatagaacaatgtagcttttgtttagagtttctgtacctgtgaacttctaaggcaacag 443  Q
    ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||    
27623185 gaggttttgatagaacaatgtagcttttgttaagagtttttgtacctgtgaacttctaaggcaacag 27623119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 15892 times since January 2019
Visitors: 3757