View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_63 (Length: 416)
Name: NF1390_low_63
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-134; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 1 - 310
Target Start/End: Original strand, 48968353 - 48968663
Alignment:
| Q |
1 |
caaatatgtcaaaatcaattttaagatgtagatctaggaccgcc---caacccgatttcaaagctctttatggcgccttcctccctccttcaagattgga |
97 |
Q |
| |
|
||||||||||||||||||| ||| | |||| ||||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48968353 |
caaatatgtcaaaatcaatcttagggtgtaaatctaggaccgccgcccagcccgatttcaaagctctttatggc--cttcctccctccttcaagattgga |
48968450 |
T |
|
| Q |
98 |
aggtatttcacttgttttatagactttgcttcagccattgccagcacacgcaatgccacataataagaatcggtcaaacagtagagtaggcaatccgcaa |
197 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48968451 |
aggtatttcactttttttatagactttgcttcagccattgccagcacacgcaatgccacataataagaatcggtcaaacagtagagtaggcaatccgcaa |
48968550 |
T |
|
| Q |
198 |
atgtagtgggaattagatacagcctcaacttccatgannnnnnngcttatacttaattaattataaaatttagcacctgtcaaaaatttacggtttacgt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48968551 |
atgtagtgggaattagatacagcctcaacttccatgatttttttgcttatacttaattaattataaaatttagcacctgtcaaaaatttacggtttacgt |
48968650 |
T |
|
| Q |
298 |
ataacatttttgt |
310 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48968651 |
ataacatttttgt |
48968663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 362 - 407
Target Start/End: Original strand, 48968709 - 48968754
Alignment:
| Q |
362 |
catatctaacacgaaaatttcatatggaattcaaaattagaataat |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48968709 |
catatctaacacgaaaatttcatatggaattcaaaattagaataat |
48968754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15776 times since January 2019
Visitors: 3757