View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_66 (Length: 397)
Name: NF1390_low_66
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_66 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 13 - 319
Target Start/End: Original strand, 30498946 - 30499252
Alignment:
| Q |
13 |
aatatctccaagtttaagatgcctactactgcaaaggttctgtttttgatatcttggtatgtaatgttatatcaatcttttgcaaattttgttgctagtt |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30498946 |
aatatctccaagtttaagatgcctaccactgcaaaggttctgtttttgatatcttggtatgtaatgttatatcaatcttttgcaaattttgttgctagtt |
30499045 |
T |
|
| Q |
113 |
gttactttaaaatgtgaattattagactnnnnnnngactaaattgttggtaatgtttatcaggcttagctttggagttgtagttatattgttgattgctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30499046 |
gttactttaaaatgtgaattattagactaaaaaaagactaaattgttggtaatgtttatcaggcttagctttggagttgtagttatattgttgattgctg |
30499145 |
T |
|
| Q |
213 |
caacaagcatgagcagaaggcagctctatgggaaaggatggttgaatggtgagtgctttctggtcaaaggaggaacttactctggctcagccatattgat |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30499146 |
caacaagcatgagcagaaggcagctctatgggaaaggatggttgaatggtgagtgctttctagtcaaaggaggaacttactctggctcagccatattgat |
30499245 |
T |
|
| Q |
313 |
ccttgtt |
319 |
Q |
| |
|
||||||| |
|
|
| T |
30499246 |
ccttgtt |
30499252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 69; Significance: 7e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 172 - 312
Target Start/End: Complemental strand, 10445554 - 10445414
Alignment:
| Q |
172 |
caggcttagctttggagttgtagttatattgttgattgctgcaacaagcatgagcagaaggcagctctatgggaaaggatggttgaatggtgagtgcttt |
271 |
Q |
| |
|
||||||||||||||||||| |||||| || | |||| ||||||||||||||||| |||||||| ||||||| ||| |||||||||||||| |||| | |
|
|
| T |
10445554 |
caggcttagctttggagttacagttattttactaattgttgcaacaagcatgagcaaaaggcagccctatggggcaggttggttgaatggtgaatgctat |
10445455 |
T |
|
| Q |
272 |
ctggtcaaaggaggaacttactctggctcagccatattgat |
312 |
Q |
| |
|
| |||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
10445454 |
ttagtcaaaggaggaacttacgcaggctcagccatattgat |
10445414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13400 times since January 2019
Visitors: 8302