View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_97 (Length: 349)
Name: NF1390_low_97
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_97 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 89 - 317
Target Start/End: Original strand, 38666787 - 38667012
Alignment:
| Q |
89 |
aacgcatttgtttgcaaagtgtgcttaattactaacaagcaaacatggtttaaagtttatggggttaagtagttcatctgatttgagttnnnnnnntaaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38666787 |
aacgcatttgtttgcaaagtgtgcttaattactaacaagcaaacatcgtttaaagtttatggggttaagtagttcatctgatttgagttaagaaaataaa |
38666886 |
T |
|
| Q |
189 |
gcgttgataaagttaaatgtgcaatatttaagttatggtaaggagnnnnnnnntactacatgacaattaacatattaatcgttgtcattnnnnnnnnnga |
288 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38666887 |
gcgttgataaagttaaatgtacaata--taagttatggtaaggaagaaaaaaatactacatgacaattaacatattaatcgttgtcatt-aaaaaaaaga |
38666983 |
T |
|
| Q |
289 |
tcaaatatttgtaaaagaaatagtattat |
317 |
Q |
| |
|
|||||||||||||||||||| |||||||| |
|
|
| T |
38666984 |
tcaaatatttgtaaaagaaagagtattat |
38667012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14944 times since January 2019
Visitors: 8422