View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503-Insertion-14 (Length: 304)
Name: NF1503-Insertion-14
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1503-Insertion-14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 8 - 304
Target Start/End: Complemental strand, 21716205 - 21715909
Alignment:
| Q |
8 |
cttggatagtaaacaacttcaaatggttggttgttagcagccaatttcacagcttccataacatcttcagccctcactcttactcttccactcaaattac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21716205 |
cttggatagtaaacaacttcaaatggttggttgttagcagccaatttcacagcttccataacatcttcagccctcactctcactcttccactcaaattac |
21716106 |
T |
|
| Q |
108 |
catcaaaacaaccatttctcaatgtcttattctcttctttcaagaaaaaagaaaatgccccaaaaggtccaattccacaatttacattgttagaaccaga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21716105 |
catcaaaacaaccatttctcaatgtcttattctcttctttcaagaaaaaagaaaatgccccaaaaggtccaattccacaatttacattgttagaaccaga |
21716006 |
T |
|
| Q |
208 |
acctgaagtccatccacaagatgaaccatcaaaaccaccaccaactccctttttcgccctacgaattccaacacacaattcaccattctgagccctc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21716005 |
acctgaagtccatccacaagatgaaccatcaaaaccaccaccaattccctttttcgccctacgaattccaacacacaattcaccattctcagccctc |
21715909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14633 times since January 2019
Visitors: 8422