View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503-Insertion-17 (Length: 166)
Name: NF1503-Insertion-17
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1503-Insertion-17 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 57; Significance: 4e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 4e-24
Query Start/End: Original strand, 84 - 140
Target Start/End: Complemental strand, 2094097 - 2094041
Alignment:
Q |
84 |
ttcatatagaattgatcgcattattactcacatagaaacttaaggttacaaaagtgt |
140 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2094097 |
ttcatatagaattgatcgcattattactcacatagaaacttaaggttacaaaagtgt |
2094041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10220 times since January 2019
Visitors: 7975