View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503-Insertion-19 (Length: 147)
Name: NF1503-Insertion-19
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1503-Insertion-19 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 2e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 8 - 147
Target Start/End: Original strand, 1945709 - 1945856
Alignment:
| Q |
8 |
taattaacatgaaatcacataacattgaagagtattatt--------tattctattctattaatcggctaatgttttcttcttatacaaacttcccatag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1945709 |
taattaacatgaaatcacataacattgaagagtattattatttattctattctattttattaatcggctaatgttttcttcttatacaagcttcccatag |
1945808 |
T |
|
| Q |
100 |
cctttgccttccctctcagaacatatttttgtgtctttccagttgatg |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1945809 |
cctttgccttccctctcagaacatatttttgtgtctttccagttgatg |
1945856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 78 - 147
Target Start/End: Original strand, 1927669 - 1927738
Alignment:
| Q |
78 |
ttcttatacaaacttcccatagcctttgccttccctctcagaacatatttttgtgtctttccagttgatg |
147 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||| | ||| |||||||||||||||||| || ||||||| |
|
|
| T |
1927669 |
ttcttagacaagcttcccatagcctttgccttctccttcaaaacatatttttgtgtcttgccggttgatg |
1927738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12677 times since January 2019
Visitors: 8223