View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503-Insertion-20 (Length: 146)
Name: NF1503-Insertion-20
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1503-Insertion-20 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 4e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 4e-30
Query Start/End: Original strand, 7 - 81
Target Start/End: Complemental strand, 32241425 - 32241351
Alignment:
Q |
7 |
agggtattcatcaaagagcttgcaattcaatctatgatattggattaacatatatattaaggtacttgctcttcc |
81 |
Q |
|
|
||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32241425 |
agggtgttcatcaatgagcttgcaattcaatctatgatattggattaacatatatattaaggtacttgctcttcc |
32241351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10123 times since January 2019
Visitors: 7975