View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503-Insertion-21 (Length: 140)
Name: NF1503-Insertion-21
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1503-Insertion-21 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 2e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 8 - 136
Target Start/End: Original strand, 39453932 - 39454060
Alignment:
Q |
8 |
agtctgaatcctgacatttatgaacttcattttacagaactatnnnnnnnnnnnncatttattatgagaagctagaaccatgagattgcattcaagagga |
107 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
39453932 |
agtccgaatcctgacatttatgaacttcattttacagaactataaaaaacaaaaacatttattatgagaagctagaaccatgagattgcagtcaagagga |
39454031 |
T |
|
Q |
108 |
aattattgtaaaaaattcaatcaacaaag |
136 |
Q |
|
|
|||||||||||||||||||||| |||||| |
|
|
T |
39454032 |
aattattgtaaaaaattcaatccacaaag |
39454060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8460 times since January 2019
Visitors: 7803