View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503-Insertion-24 (Length: 95)
Name: NF1503-Insertion-24
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1503-Insertion-24 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 6e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 6e-31
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 28884253 - 28884186
Alignment:
Q |
8 |
cttttttatcaaaccaatcaccccaaccttctctcaaaggcgataccttcttcccaattttcaacaaa |
75 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28884253 |
cttttttatcaaaccaatcaccccaaccttctctcaaaggcgataccttcttcccaattttcaacaaa |
28884186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11230 times since January 2019
Visitors: 8059