View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503_high_29 (Length: 240)
Name: NF1503_high_29
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1503_high_29 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 223
Target Start/End: Original strand, 16829719 - 16829921
Alignment:
Q |
21 |
gaatctctaaaatttctcaacaaagcaatcacaaacaaaccaattcattcatcactacaatgcacaattcaacaactagaagatgtcaaactagtgttca |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
T |
16829719 |
gaatctctaaaatttctcaacaaagcaatcacaaacaaaccaattcattcatcactacaatgcacaatccaacaactagaagatgtcaaactagtcttca |
16829818 |
T |
|
Q |
121 |
aaatattcccgattttcgcgtgcacaatcatgctcaacgcttgcttagctcaactctccacattctcagtcgaacaagccgccacaatgaacacagccct |
220 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
T |
16829819 |
aaatattcccgattttcgcgtgcacaatcatgctcaacgcttgcttagctcaactctccacattctcagtcgaacaagccgcgacaatgaacacaaccct |
16829918 |
T |
|
Q |
221 |
ctt |
223 |
Q |
|
|
||| |
|
|
T |
16829919 |
ctt |
16829921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 94 - 215
Target Start/End: Complemental strand, 25170764 - 25170643
Alignment:
Q |
94 |
aactagaagatgtcaaactagtgttcaaaatattcccgattttcgcgtgcacaatcatgctcaacgcttgcttagctcaactctccacattctcagtcga |
193 |
Q |
|
|
|||| ||||| || ||| |||| || ||||| |||| |||||||| |||||||| | || ||| ||||||||||||||| || |||||||||||||| |
|
|
T |
25170764 |
aactcgaagacgtaaaaatagtcttaaaaatcctcccaattttcgcctgcacaattgtcctaaactgttgcttagctcaactatcaacattctcagtcga |
25170665 |
T |
|
Q |
194 |
acaagccgccacaatgaacaca |
215 |
Q |
|
|
||||||||| |||||||||||| |
|
|
T |
25170664 |
acaagccgcgacaatgaacaca |
25170643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14837 times since January 2019
Visitors: 8422