View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1503_high_30 (Length: 239)

Name: NF1503_high_30
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1503_high_30
NF1503_high_30
[»] chr8 (2 HSPs)
chr8 (12-116)||(30037600-30037704)
chr8 (20-109)||(30053646-30053735)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 12 - 116
Target Start/End: Original strand, 30037600 - 30037704
Alignment:
12 gataatacttttactaagaaggataatgttattgagagtgatgcttttgattacagtggagggtacacactttcaacaaaagtggaacccaaatagatga 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30037600 gataatacttttactaagaaggataatgttattgagagtgatgcttttgattacagtggagggtacacactttcaacaaaagtggaacccaaatagatga 30037699  T
112 tataa 116  Q
    |||||    
30037700 tataa 30037704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 20 - 109
Target Start/End: Original strand, 30053646 - 30053735
Alignment:
20 ttttactaagaaggataatgttattgagagtgatgcttttgattacagtggagggtacacactttcaacaaaagtggaacccaaatagat 109  Q
    |||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||| |  |||||||||||||||||||    
30053646 ttttacaaagaaggatgatggtattgagagtgatgcttttgattacagtggagggtacacattttcatctgaagtggaacccaaatagat 30053735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 8400 times since January 2019
Visitors: 7802