View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503_high_36 (Length: 224)
Name: NF1503_high_36
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1503_high_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 28637638 - 28637453
Alignment:
| Q |
20 |
ttgagatggataggattttaaggccacaagggagtgtgatattgcgtgatgatgtggatgtgttgttgaaggtaaaaagatttgcagatgcaatgcaatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28637638 |
ttgagatggataggattttaaggccacaagggagtgtgatattgcgtgatgatgtggatgtgttgttgaaggtaaaaagatttgcagatgcaatgcaatg |
28637539 |
T |
|
| Q |
120 |
ggatgctagaattgcagaccatgaaaagggaccacaccaaagagaaaagatacttgtagcagtcaagcagtattggacagccccac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28637538 |
ggatgctagaattgcagaccatgaaaagggaccacaccaaagagaaaagatacttgtagcagtcaagcagtattggacagccccac |
28637453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 12400010 - 12399822
Alignment:
| Q |
17 |
ttcttgagatggataggattttaaggccacaagggagtgtgatattgcgtgatgatgtggatgtgttgttgaaggtaaaaagatttgcagatgcaatgca |
116 |
Q |
| |
|
|||| |||||||| ||||||| | || ||||| ||||| || ||||| || |||| ||||||||| |||||| || || ||||||||| |||||| |
|
|
| T |
12400010 |
ttctggagatggaccggattttgcgtccgcaaggtagtgtaattttgcgcgacaatgtagatgtgttgacgaaggtgaagagcattgcagatgaaatgca |
12399911 |
T |
|
| Q |
117 |
atgggatgctagaattgcagaccatgaaaagggaccacaccaaagagaaaagatacttgtagcagtcaagcagtattggacagccccac |
205 |
Q |
| |
|
|||||||| | |||| |||||||||| | ||||| | |||| ||||||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
12399910 |
gtgggatgcaaaaattagagaccatgaagaaggaccttatcaaaaagaaaagatacttgtagcagtcaagcaatactggacagctccac |
12399822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14251 times since January 2019
Visitors: 8375