View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503_high_38 (Length: 208)
Name: NF1503_high_38
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1503_high_38 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 84 - 188
Target Start/End: Complemental strand, 52391245 - 52391141
Alignment:
Q |
84 |
taaagaaaattatccatgtttgtaatatgatgattattttctactacctctttctgtcaacaattaaatttattctcctcccttgttttcattcctaatg |
183 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
52391245 |
taaagaaaattatccatgtttgtaatatgatgattattttctactacctctttctgtcaacaattatatttattctcctcccttgttttcattcctaatg |
52391146 |
T |
|
Q |
184 |
accaa |
188 |
Q |
|
|
||||| |
|
|
T |
52391145 |
accaa |
52391141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14765 times since January 2019
Visitors: 8422