View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503_high_9 (Length: 417)
Name: NF1503_high_9
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1503_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 17 - 412
Target Start/End: Complemental strand, 39022286 - 39021891
Alignment:
| Q |
17 |
gtaagcagcctaacacaatcctcaccgacaagatcacgtgatgggcttcgtgcagtttactacgtacaaagcccatcacgggactcttccaacgacggtg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39022286 |
gtaagcagcctaacacaatcctcaccgacaagatcacgtgatgggcttcgtgcagtttactacgtacaaagcccatcacgggactcttccaacgacggtg |
39022187 |
T |
|
| Q |
117 |
agaaaacaacaaactccttcaactcaagccctcttcaaagcccgttgggatctcctcctcattctcattccaactcatcgttgggcccacattcacgtga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39022186 |
agaaaacaacaaactccttcaactcaagccctcttcaaagcccgttgggatctcctcctcattctcattccaactcatcgttgggcccacattcacgtga |
39022087 |
T |
|
| Q |
217 |
atcttcttccaccagatactctgcctcacgtaagagcagtcaagcttcccataataacaggaaaggtaattggcgtccttggaaggatcagttcaatgcc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39022086 |
atcttcttccaccagatactctgcctcacgtaagagcagtcaagcttcccataataacaggaaaggtaattggcgtccttggaaggatcagttcaatgcc |
39021987 |
T |
|
| Q |
317 |
attgaagaagaagggcttctnnnnnnnnnnnnnnnnncagatcgtggattccctaggagatgctattttcctgcttttgttgtttgtttctctgtt |
412 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
39021986 |
attgaagaagaagggcttcttgatgatgatgatgatgcagatcgtggattccctaggagatgttattttcctgcttttgttgtttgtttctttgtt |
39021891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14034 times since January 2019
Visitors: 8375