View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503_low_23 (Length: 302)
Name: NF1503_low_23
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1503_low_23 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 19 - 292
Target Start/End: Complemental strand, 36508975 - 36508702
Alignment:
Q |
19 |
tacagtgggtaagactcttgaatgctttcttgcaagaagcaaaatggtttgcttctgggaatgttccaaagtcagaggagtatttgaagaatgccatagt |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36508975 |
tacagtgggtaagactcttgaatgctttcttgcaagaagcaaaatggtttgcttctgggaatgttccaaagtcagaggagtatttgaagaatgccatagt |
36508876 |
T |
|
Q |
119 |
aagcactggggtacacgtgatacttgtgcatgctttcttttccatgggtcaaggtataactgagaaaaccgtgtctctaatggatgacttcccaaccatt |
218 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36508875 |
aagcactggggtacacgtgatacttgtgcatgctttcttttgcatgggtcaaggtataactgagaaaaccgtgtctctaatggatgacttcccaaccatt |
36508776 |
T |
|
Q |
219 |
atatctacaacagccaaaattctaaggctatgtgatgacttggaaggcgacaaggtaggaaaacatcacctatg |
292 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
36508775 |
atatctacaacagccaaaattctaaggctatgtgatgacttggaaggcgataaggtaggaaaacatcacctatg |
36508702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 234 - 289
Target Start/End: Complemental strand, 37339314 - 37339259
Alignment:
Q |
234 |
aaaattctaaggctatgtgatgacttggaaggcgacaaggtaggaaaacatcacct |
289 |
Q |
|
|
|||||||||||| ||||||||||||||||| ||||||||||| |||||||| |||| |
|
|
T |
37339314 |
aaaattctaaggttatgtgatgacttggaaagcgacaaggtaagaaaacattacct |
37339259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 156 - 223
Target Start/End: Complemental strand, 37339997 - 37339930
Alignment:
Q |
156 |
ttttccatgggtcaaggtataactgagaaaaccgtgtctctaatggatgacttcccaaccattatatc |
223 |
Q |
|
|
|||| ||||||| ||| ||||| ||| ||||||| |||||||||||| ||||||| ||||||||||| |
|
|
T |
37339997 |
ttttacatgggtaaagatataattgaaaaaaccgagtctctaatggacaacttccctaccattatatc |
37339930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13405 times since January 2019
Visitors: 8302