View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503_low_24 (Length: 297)
Name: NF1503_low_24
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1503_low_24 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 280
Target Start/End: Original strand, 44237481 - 44237731
Alignment:
Q |
13 |
aatattcgaggcgctgggattcctagaaaacctaatcccgctaatatattgtagtataaaaccatgaaataaacacattcttggtccaaaacatccttag |
112 |
Q |
|
|
||||||| ||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
44237481 |
aatattccaggcgctaggattcctagaaaacctaatccctctaatatattgtagtataaaaccatgaaataaacacat----------------ccttag |
44237564 |
T |
|
Q |
113 |
tccaaaccaactaaactactcatctccaaaatggaaatcaaattccctttccttaccttactttactttcctttcattttctgcgcgcggtagatctaat |
212 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44237565 |
tccaaaccaactaaactgctcatctccaaaatggaaatcaaattccctttccttaccttactttactttcctttcattttctgcgcgcggtagatctaat |
44237664 |
T |
|
Q |
213 |
tccctttctttttcatctcactcttgtgaagaaggtaataatgaattgcatatgcaatgccacgcagt |
280 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
44237665 |
tccctttctttttcatctcactcttgtgaagaaggtaataatgaattgcatatgc-atgccacgcagt |
44237731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7624 times since January 2019
Visitors: 7737