View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503_low_27 (Length: 276)
Name: NF1503_low_27
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1503_low_27 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 17 - 270
Target Start/End: Original strand, 2425532 - 2425785
Alignment:
Q |
17 |
agatgtacctccatggctgctgcattgcatattagaagagtgcaaagtaatagatgttgattttttacaaccggtaatattttctctgtcaccacaaaaa |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2425532 |
agatgtacctccatggctgctgcattgcatattagaagagtgcaaagtaatagatgttgattttttacaaccggtaatattttctctgtcaccacaaaaa |
2425631 |
T |
|
Q |
117 |
ataataacacaaagttcacatagataattgagtatacattcgtaatcacggtgaatttgacaaaatcatcgtaacatcaagaatttctggataaaacagt |
216 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
2425632 |
ataataacacaaagttcacatagataattgagtatacattcgtaatcacggtgaatttgacaaaatcatcgtaacatcaagaatttctggatagaacagt |
2425731 |
T |
|
Q |
217 |
accagcatgttttcgatcttgaggtgttccagatttagcaagaacctcaagatc |
270 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2425732 |
accagcatgttttcgatcttgaggtgttccagatttagcaagaacctcaagatc |
2425785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8312 times since January 2019
Visitors: 7802