View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503_low_34 (Length: 239)
Name: NF1503_low_34
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1503_low_34 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 12 - 116
Target Start/End: Original strand, 30037600 - 30037704
Alignment:
Q |
12 |
gataatacttttactaagaaggataatgttattgagagtgatgcttttgattacagtggagggtacacactttcaacaaaagtggaacccaaatagatga |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30037600 |
gataatacttttactaagaaggataatgttattgagagtgatgcttttgattacagtggagggtacacactttcaacaaaagtggaacccaaatagatga |
30037699 |
T |
|
Q |
112 |
tataa |
116 |
Q |
|
|
||||| |
|
|
T |
30037700 |
tataa |
30037704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 20 - 109
Target Start/End: Original strand, 30053646 - 30053735
Alignment:
Q |
20 |
ttttactaagaaggataatgttattgagagtgatgcttttgattacagtggagggtacacactttcaacaaaagtggaacccaaatagat |
109 |
Q |
|
|
|||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||| |
|
|
T |
30053646 |
ttttacaaagaaggatgatggtattgagagtgatgcttttgattacagtggagggtacacattttcatctgaagtggaacccaaatagat |
30053735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14127 times since January 2019
Visitors: 8375