View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503_low_35 (Length: 239)
Name: NF1503_low_35
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1503_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 225
Target Start/End: Original strand, 32321601 - 32321815
Alignment:
| Q |
11 |
cagagagcatgaggccaatatccatgcttaaaaaggccacacccaagaatgcactcatgcagataataaaatcaaacttatcaactttaaagagatgaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32321601 |
cagagagcatgaggccaatatccatgcttaaaaaggccacacccaagaatgcactcatgcagataataaaatcaaacttatcaactttaaagagatgaat |
32321700 |
T |
|
| Q |
111 |
agcttctgtatagtttatcaaccctaacatggctgatacaatgatagctgatagagcaacaagtggtgtgttgctaaataatggtgccaaaaattgtagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32321701 |
agcttctgtatagtttatcaaccctaacatggctgatacaatgatagctgatagagcaacaagtggtgtgttgctaaataatggtgccaaaaattgtagt |
32321800 |
T |
|
| Q |
211 |
gttagagccattatt |
225 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32321801 |
gttagagccattatt |
32321815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13200 times since January 2019
Visitors: 8270