View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1503_low_41 (Length: 209)
Name: NF1503_low_41
Description: NF1503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1503_low_41 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 10 - 194
Target Start/End: Original strand, 25813928 - 25814112
Alignment:
Q |
10 |
acatcatcaactgagttgtggtttcaaaagaaactctacaaatgcagacatatgattcgtgaggctataaattctgatggatactgggtactaagaagat |
109 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
T |
25813928 |
acatcattaactgagttgtggtttcaaaagaaactctacaaatgcagacatatgattcgtgaggctattaattctgatggatactgagtactaagaagat |
25814027 |
T |
|
Q |
110 |
cgtggccaaataatttggtatactcaaaggtatgtgttgatcaatttgaagcatgcaaagaaccacaactaaagaaaggtctttg |
194 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
25814028 |
cgtggccaaataatttggtatactcaaaggtatgtgttgatcaatttgaagcatgcaaagaacaacaactaaagaaaggtctttg |
25814112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10167 times since January 2019
Visitors: 7975