View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1565_high_20 (Length: 252)
Name: NF1565_high_20
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1565_high_20 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 43742919 - 43743131
Alignment:
Q |
18 |
acaacttagtactttgaagagtttacatcaatgataagatatttgatgtagtacggagtttactcacacaaagagaatgatgacgtttctagctcaatac |
117 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
43742919 |
acaacttggtactttgaagagtttacatcaatgataagataca------agtacagagtttactcacacagagagaatgatgacgtttctagctcaatac |
43743012 |
T |
|
Q |
118 |
aagtgtataatattttgatggaaagtgtatgaaatgaatagcacttgtgtctttctttatttcaagtgtagctttttctcttgcgcttgtaagtttggtg |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43743013 |
aagtgtataatattttgatggaaagtgtatgaaatgaatagcacttgtgtctttctttatttcaagtgtagctttttctcttgcgcttgtaagtttggtg |
43743112 |
T |
|
Q |
218 |
ctatttcacatcggaaagt |
236 |
Q |
|
|
|||||||| || ||||||| |
|
|
T |
43743113 |
ctatttcatatgggaaagt |
43743131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10179 times since January 2019
Visitors: 7975