View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1565_high_26 (Length: 227)
Name: NF1565_high_26
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1565_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 10812561 - 10812776
Alignment:
| Q |
1 |
atatagagggaaaggatctagagttgcactttcatattgatgtaaatttggaccgttggatcaagatcggataaatcatgatcata-ttttttgttttaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10812561 |
atatagagggaaaggatctagagttgcactttcatattgatgtaaatttggacggttggatcaagatcggataaatcatgatcatatttttttgttttaa |
10812660 |
T |
|
| Q |
100 |
atttatcttgcaaagtg-tgggaaatgtgaaattaagagaaaattttaggacaactcggagtatact-nnnnnnnngagaactcataaatttaatggagt |
197 |
Q |
| |
|
| ||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
10812661 |
aattatcttgcaaagtgttgggaaatgtgaaattaagagaaaattttaggataactcggagtatactaaaaaaaaagagaactcacaaatttaatggagt |
10812760 |
T |
|
| Q |
198 |
tcggccctcaatacct |
213 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10812761 |
tcggccctcaatacct |
10812776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15865 times since January 2019
Visitors: 3757