View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1565_high_27 (Length: 209)
Name: NF1565_high_27
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1565_high_27 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 2820204 - 2820377
Alignment:
Q |
18 |
aacttgtgctaaacttattgctaaccctgtcatccccagattcttgtatgaaaatagtggatcacatcagctaagaaaatggttaattcattatcattcc |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2820204 |
aacttgtgctaaacttattgctaaccctgtcatccccagattcttgtatgaaaatagtggatcacatcagctaagaaaatggttaattcattatcattcc |
2820303 |
T |
|
Q |
118 |
cctaatcttttgttttgataatcaatgtggttttatt-aatgatgacacatttggtagttctttttaggtacac |
190 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
2820304 |
cctaatcttttgttttgataatccatgtggttttattgaatgatgacacatttggtagttctttttaggtacac |
2820377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 36 - 188
Target Start/End: Original strand, 2827550 - 2827707
Alignment:
Q |
36 |
tgctaaccctgtca----tccccagattcttgtatgaaaatagtggatcacatcagctaagaaaatggttaattcattatcattcccctaatcttttgtt |
131 |
Q |
|
|
|||||||||||||| ||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
2827550 |
tgctaaccctgtcaattgtccccggattcttgtatgaaaatactggatcacatcagctaggaaaatggttaattcattatcatttccctaatcttttgtt |
2827649 |
T |
|
Q |
132 |
ttgataatcaatgtggttttatta-atgatgacacatttggtagttctttttaggtac |
188 |
Q |
|
|
|| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
2827650 |
ttaataatccatgtggttttattacatgatgacacatttggtagttctttttaggtac |
2827707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15867 times since January 2019
Visitors: 3757