View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1565_low_21 (Length: 256)
Name: NF1565_low_21
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1565_low_21 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 43746402 - 43746155
Alignment:
Q |
1 |
atcctttctgttacatttatttttcacccctggctacaagaaacaacc-------------ttattgtaactataagtaataaccacatttcttttttaa |
87 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43746402 |
atcctttctgttacatttatttttcaccccttgctacaagaaacaacactgtcatcatcatttattgtaactataagtaataaccacatttcttttttaa |
43746303 |
T |
|
Q |
88 |
tctttattttatgtatgtattaggttttcatgtataaatctcatgattctgaattagacgatggttaacaaggttgtaagtttttcccttcagtgtttcg |
187 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43746302 |
tctttattttatgtat----taggttttcatgtataaatctcatgattctgaattagacgatggttaacaaggttgtaagtttttcccttcagtgtttcg |
43746207 |
T |
|
Q |
188 |
gtgctggcttgtgttgtctttgttttcgttttcgttttctccattgtacttc |
239 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43746206 |
gtgctggcttgtgttgtctttgttttcgttttcgttttctccattgtacttc |
43746155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 64 - 97
Target Start/End: Original strand, 39118780 - 39118813
Alignment:
Q |
64 |
gtaataaccacatttcttttttaatctttatttt |
97 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| |
|
|
T |
39118780 |
gtaagaaccacatttcttttttaatctttatttt |
39118813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11258 times since January 2019
Visitors: 8059