View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1565_low_26 (Length: 241)
Name: NF1565_low_26
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1565_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 7037874 - 7037658
Alignment:
| Q |
18 |
ggtgcgacaaggaactaagaaaacaaagagattaagtaaaaatttaatataaaataagaaaatcaattgaagttaataaggtggaagtatcacacatctg |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
7037874 |
ggtgcgacaaggaaccaagaaaacaaagagattaagtaaaaatttaatataaaataagaaaatcaattgaagttaataaggcgaaagtatcacacatcta |
7037775 |
T |
|
| Q |
118 |
cctctcttatgtgtctggccacatagttcgcatacaatgacaaatcgtatgggacactgagagattactcccctagttgttttggcggtgtatcctcctc |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||||||||||| |
|
|
| T |
7037774 |
cctctgttatgtgtctggccacatagttcgcatacaatgacaaatcgtatgggacactgagagatgactccgttagttgttttggcagtgtatcctcctc |
7037675 |
T |
|
| Q |
218 |
ctaatctatctctgctc |
234 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
7037674 |
ctaatctatctttgctc |
7037658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13535 times since January 2019
Visitors: 8302