View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1565_low_28 (Length: 238)
Name: NF1565_low_28
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1565_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 29 - 234
Target Start/End: Complemental strand, 14100712 - 14100507
Alignment:
| Q |
29 |
ataaaatgttgtgtactagtacacttgcccttaacataagatagtaggaatgtgcactgcactctcatgttttgcactttattaacacgagtacatattt |
128 |
Q |
| |
|
||||||||||||||||||||| || || || ||| | ||||||||| ||||||||||||||| ||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
14100712 |
ataaaatgttgtgtactagtagaccggcactcaacgtcagatagtagaaatgtgcactgcactttcatgttttgcacttcattaacactagtacatattt |
14100613 |
T |
|
| Q |
129 |
ataaccactttgcctctctccacatgccaaagttaacgatgtgggacttccttcaactatttgttttaaaactcaattataatgcaggcatcagaatgtg |
228 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14100612 |
ataaccactttgcctctctccacataccaaagttaacgatgtgggacttccttcaactatttgttttaaaactcaattataatgtaggcatcagaatgtg |
14100513 |
T |
|
| Q |
229 |
gggctt |
234 |
Q |
| |
|
| |||| |
|
|
| T |
14100512 |
gagctt |
14100507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 128 - 177
Target Start/End: Complemental strand, 14113322 - 14113272
Alignment:
| Q |
128 |
tataaccactttgcctctctcc-acatgccaaagttaacgatgtgggactt |
177 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14113322 |
tatagccactttgcctctctcttacatgccaaagttaacgatgtgggactt |
14113272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8433 times since January 2019
Visitors: 7802