View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1565_low_34 (Length: 204)
Name: NF1565_low_34
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1565_low_34 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 9424464 - 9424266
Alignment:
Q |
1 |
agcttgagaggaaagtataatataaccataaggagattgggagataaatgaacttacaatatcaccattagaaattcctaagttgaccaaagcagaagca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9424464 |
agcttgagaggaaagtataatataaccataaggagattgggagataaatgaacttacaatatcaccattagaaattcctaagttgaccaaagcagaagca |
9424365 |
T |
|
Q |
101 |
agcttgagacatctttcataggtttctctccaagaaaatctaacatgatcattgtagatgatggaaactttgtcaccatacacaggttctgctcgttca |
199 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
9424364 |
agcttgagacatctttcataggtttctctccaagaaaatctaacatgatcattgtagatgatggaaactttgtcaccatacacagtggctgctcgttca |
9424266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7669 times since January 2019
Visitors: 7737