View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1565_low_36 (Length: 203)
Name: NF1565_low_36
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1565_low_36 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 22 - 189
Target Start/End: Original strand, 4191748 - 4191915
Alignment:
Q |
22 |
acctaagcattcaactgagatctgattagtatgcggtcgaaattgcatgaagtcatgtagtcaaatgagatttgaccgtataattagtatcagacaatcc |
121 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
4191748 |
acctaagcattcaactgagatctgattagtatgcggtcgaaattgcatgaagtcatgtagtcaaatgagatttgaccgtataattagtatcagacgatcc |
4191847 |
T |
|
Q |
122 |
aaattgaaaacaagttttttcttattatttaagctattagcgtaaatttatatatttcaatcttcatc |
189 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4191848 |
aaattgaaaacaagttttttcttattatttaagctattagcgtaaatttatatatttcaatcttcatc |
4191915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8517 times since January 2019
Visitors: 7803