View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566-INSERTION-3 (Length: 193)
Name: NF1566-INSERTION-3
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1566-INSERTION-3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 10 - 191
Target Start/End: Complemental strand, 11723046 - 11722865
Alignment:
| Q |
10 |
tgtggccaaggatgctggtggtgatggtggatttgctgttggagaagttgagggtgtttatgccttagcacaatgctggaaaactcttgggattgatggg |
109 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11723046 |
tgtggccaaggatgctggtgatggtggtggatttgctgttggagaggttgagggtgtttatgccttagcacaatgctggaaaactcttgggattgatggg |
11722947 |
T |
|
| Q |
110 |
tgtagagattgtttgaacaatgctgtgaagaaggttagagggtgtttgccaaatagtgaaggtagggttttgaatgctggat |
191 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11722946 |
tgtagagattgtttgagcaatgctgttaagaaggttagagggtgtttgccaaatagtgaaggtagggttttgaatgctggat |
11722865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8507 times since January 2019
Visitors: 7803