View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_high_12 (Length: 390)
Name: NF1566_high_12
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1566_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 14 - 375
Target Start/End: Original strand, 53805211 - 53805572
Alignment:
| Q |
14 |
ttctaactccggtaactttttctccaaaattgaactctcttcttttaaattagcttccttatttttcccttctccgttttctgtctcactcacgttaact |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805211 |
ttctaactccggtaactttttctccaaaattgaactctcttctttcaaattagcttccttatttttcccttctccgttttctgtctcactcacgttaact |
53805310 |
T |
|
| Q |
114 |
ccgttagatttaacacactcacttttctgagtcacgtgaccgttaacnnnnnnnnnnnnnnnnnnnnnnnnatccgttatgttggtgtcagtgtaaccgt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
53805311 |
ccgttagatttaacacactcacttttctgagtcacgtgaccgttaaccttttccttttccttttctttttcatccgttatgctggtgtcagtgtaaccgt |
53805410 |
T |
|
| Q |
214 |
ccccaccgtgactgtaacgtactttgaatttctcgtacggttcaaagaagtccaaaaattcccaagcagagttgctcggaggaggcggtgacggcggatt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805411 |
ccccaccgtgactgtaacgtactttgaatttctcgtacggttcaaagaagtccaaaaattcccaagcagagttgctcggaggaggcggtgacggcggatt |
53805510 |
T |
|
| Q |
314 |
taaaccggaaaagttttcggtggtattcaacggaggcggaggagaataggaatcgtagatag |
375 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53805511 |
taaaccggaaaagtttccggtggtattcgacggaggcggaggagaataggaatcgtagatag |
53805572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11443 times since January 2019
Visitors: 8091