View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_high_13 (Length: 382)
Name: NF1566_high_13
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1566_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 1 - 363
Target Start/End: Original strand, 39109394 - 39109756
Alignment:
| Q |
1 |
ccgcttttcacaagctctgattatcaatctgctatggactcggtatgcagaaggattggtgtgacagataaatgcaacaagcaaagctttcaaaatcaag |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39109394 |
ccgcttttcacaagctctgactatcaatctgctatggactcggtatgcagaaggattggtgtgacagataaatgcaacaagcaaagctttcaaaatcaag |
39109493 |
T |
|
| Q |
101 |
ttcttcggaaagggtgtgagagaattggtttaaaagtcgagtcagttgcagtgaatgcttcagaagatcattattgcggttcgtgctgttacggttgtag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39109494 |
ttcttcggaaagggtgtgagagaattggtttaaaagtcgagtcagttgcagtgaatgcttcagaagatcattattgcggttcgtgctgttacggttgtag |
39109593 |
T |
|
| Q |
201 |
aaccggagataaaaagggtactgactcaacttggttggttgatgctgttgaaaatggcgcagttatcctcactggatgtagagctgagaaattcataata |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39109594 |
aaccggagataaaaagggtactgactcaacttggttggttgatgctgttgaaaatggcgcagttatcctcactggatgtagagctgagaaattcataata |
39109693 |
T |
|
| Q |
301 |
gaaaatgggaagaatggaacaaagagaaagaattgctcaggagtgattgctgcaacaagttgg |
363 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39109694 |
gaaaatgggaagaatgaaacaaagagaaagaattgctcaggagtgattgctgcaacaagttgg |
39109756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16274 times since January 2019
Visitors: 3768