View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1566_high_16 (Length: 330)
Name: NF1566_high_16
Description: NF1566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1566_high_16 |
| |
|
[»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 17 - 330
Target Start/End: Original strand, 13975100 - 13975413
Alignment:
Q |
17 |
aatttttgggagacaaaaccattgaagaggtggatgcaactgcaaaggttatgaaagagagggtaaaagagggagcatctctaggagaagaaaagggttt |
116 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13975100 |
aatttttgggagacaaaaccatagaagaggtggatgcaactgcaaaggttatgaaagagagggtaaaagagggagcatctctaggagaagaaaagggttt |
13975199 |
T |
|
Q |
117 |
ggaatttgtgttaactaaagttcaaaaaagaaagagcgtgcgtcttttagatatcacttgaaagaaaaatccattaaagggagattcaattaataaaaat |
216 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13975200 |
ggaatttgtgttaactaaagttcaaaaaagaaagagcgtgcgtcttttagatatcacttgaaagaaaaatccattaaagggagattcaattaataaaaat |
13975299 |
T |
|
Q |
217 |
aaatagtaaataacatgaatgagtttcagtttataaaaggccaaatgccctaaattagggtttaattagcagtaccatccgggtattatctcttgttggt |
316 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
13975300 |
aaatagtaaataacatgaatgagtttcagtttataaatggccaaatgccctaaatttgggtttaattagcagtacgatccgggtattatctcttgttggt |
13975399 |
T |
|
Q |
317 |
ttaactcattatga |
330 |
Q |
|
|
|||| ||||||||| |
|
|
T |
13975400 |
ttaaatcattatga |
13975413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15915 times since January 2019
Visitors: 3757